F, 7 January 2021 | Pharmaceutics, Vol. mutation causing epidermolysis bullosa simplex with variable phenotype, Neurotrophic factor GDNF promotes survival of salivary stem cells, Areca Nut Components Affect COX-2, Cyclin B1/cdc25C and Keratin Expression, PGE2 Production in Keratinocyte Is Related to Reactive Oxygen Species, CYP1A1, Src, EGFR and Ras Signaling, Wnt11 Is Required for Oriented Migration of Dermogenic Progenitor Cells from the Dorsomedial Lip of the Avian Dermomyotome, Post-natal changes in MCT1 expression in the forestomach of calves, A simple material model to generate epidermal and dermal layers in vitro for skin regeneration, SAP domain-dependent Mkl1 signaling stimulates proliferation and cell migration by induction of a distinct gene set indicative of poor prognosis in breast cancer patients, Proteomic profile of keratins in cancer of the gingivo buccal complex: Consolidating insights for clinical applications, Proteomic identification of keratin alterations with enhanced proliferation of oral carcinoma cells by loss of mucosa-associated lymphoid tissue 1 expression, The expanding significance of keratin intermediate filaments in normal and diseased epithelia, Understanding the Role of Keratins 8 and 18 in Neoplastic Potential of Breast Cancer Derived Cell Lines, Porcine cholecystderived scaffold promotes full-thickness wound healing in rabbit, Identification of Novel Cholesteatoma-Related Gene Expression Signatures Using Full-Genome Microarrays, Fascin overexpression promotes neoplastic progression in oral squamous cell carcinoma, StemLike Epithelial Cells Are Concentrated in the Distal End of the Fallopian Tube: A Site for Injury and Serous Cancer Initiation, Spatiotemporal regulation of keratin 5 and 17 in the axolotl limb, Damage of hair follicle stem cells and alteration of keratin expression in external radiation-induced acute alopecia. Since cell differentiation and Notch 1 activation have been shown to be associated with cell adhesion (Watt et al., 2008), we analyzed cellextracellular matrix (ECM) and cellcell adhesion in K14 knockdown and vector control cells (methods described in Supplemental Material). Recent scholarship has shown that sauropsid -keratins are fundamentally different from -keratins at a genetic and structural level. It undergoes dephosphorylation to form filaggrin, a histidine-rich protein which acts as a matrix glue and facilitates filament aggregation into even larger bundles. K14 knockdown in both cell lines resulted in significant reduction in cell proliferation (Figure 2, A and B). 8, 28 April 2020 | Frontiers in Cellular and Infection Microbiology, Vol. 67, No. The keratins in the basal proliferating layer of these epithelia are K5/K14 (Moll et al., 1982). Silk found in insect pupae, and in spider webs and egg casings, also has twisted -pleated sheets incorporated into fibers wound into larger supermolecular aggregates. p < 0.01. Ptaeroxylon obliquum
Keratins (also described as cytokeratins) are polymers of type I and type II intermediate filaments that have been found only in chordates (vertebrates, amphioxus, urochordates). 4, 20 December 2012 | PLoS ONE, Vol. They infiltrate adjacent tissues, including frequent vascular and neural invasion. FIGURE 5: Activation of Notch1 signaling upon K14 knockdown. PI3-kinase is known to phosphorylate Ser473 residue of Akt, leading to its complete activation (Alessi et al., 1997). Future studies using conditional knockout model will give us insights into the exact function of K5 and K14 in cell proliferation. The tumors derived from the vector control (pTU6-AW1) showed higher levels of K14 as compared with the tumors derived from the K14 knockdown clones (shRK14-K7 and -K9; Figure 6C). Tumors that express keratin include carcinomas, thymomas, sarcomas and trophoblastic neoplasms. (A and E) Western blot analysis of stable K14GFP-R clones (D1-K14GFP-R11 and -R12) and pEGFP clone (D1-pEGFP) derived from K14 knockdown clone shRK14-D1 cells with antibodies to GFP, K5, involucrin, Notch1, and phosphorylated form of Akt. 22, 1 October 2021 | International Journal of Molecular Sciences, Vol. Interestingly, the K5/K14 pair is expressed in the basal layer of the epidermis, which contains epidermal stem cells and transient amplifying (TA) cells, while the K1/K10 pair is synthesized only in postmitotic keratinocytes (Coulombe et al., 1989; Byrne et al., 1994). A second polypeptide, loricrin, is localized to the keratohyaline granules. 2, 15 February 2017 | PLOS ONE, Vol. The mean fluorescence intensity (+SD) of K5 and K14 was calculated per cell by measuring fluorescence intensity of 20 cells of each experiment (using LSM10 software; Carl Zeiss MicroImaging GmbH, Jena, Germany) and is shown in the graph on the right-hand side. Thus our results suggest that K14 modulates cell proliferation in stratified epithelia, possibly through the PI3K/Akt pathway. 1, 17 November 2020 | The FASEB Journal, Vol. Krt14
Stable clones D1-pEGFP and D1-K14GFP (R11, R12) were obtained after transfection with pEGFP and K14GFP-RR, respectively. 12, 10 June 2014 | The Laryngoscope, Vol. A growth curve was prepared from three independent experiments by plotting OD at 540 nm (on y-axis) against time (on x-axis). 21, 6 November 2021 | Molecules, Vol. Oligonucleotides 5CAGCGAGCTGGTGCAATCCGGCAAGAGCGAGATCTCG3 from Sigma) were designed according to the manufacturer's protocol. 44, No. These results are suggestive of the fact that decreased tumorigenicity upon K14 depletion could be a combined effect of inhibition of the PI3K/Akt-dependent cell proliferation pathway and activation of Notch1 signaling. and
This observation ensures the specificity of our K14 shRNA, especially since the keratins share a great deal of homology at the sequence level. 2018- Strikers FC Academy . 57, No. These antibodies are used as fluorescent markers to distinguish subsets of mouse thymic epithelial cells in genetic studies of the thymus. 125, 22 April 2021 | Microbial Ecology, Vol. Working dilutions for different antibodies were as follows K5, K14, K8, and K18: 1:200; Notch1, p63, involucrin, and K1: 1:100; and Ki67 was ready to use (antibody details described in Antibodies). Total Akt was used as loading control for the phosphorylated form of Akt while -actin was used as loading control for the rest of the antibodies. Five-micron sections of Formalin-fixed and paraffin-embedded tissues were stained with hematoxylin/eosin for histology. For cell cycle analysis, cells were plated in 60-mm dishes at 20% confluency. Several proteins are involved in the formation of the cell envelope including loricrin, involucrin, keratolinin, and small proline-rich proteins.4,14 Polymerization and crosslinking of these proteins requires the action of calcium-dependent epidermal transglutaminases, of which three have been identified in the skin. (C and D) Colony-forming assay in K14 knockdown cells. These results indicate that depletion of K14 led to up-regulation of differentiation markers, such as involucrin and K1, in these cell lines. 10, 9 April 2020 | International Journal of Molecular Sciences, Vol. The degree of keratinization has not been associated with patient outcomes, whereas single cell invasion, high-grade budding, large nuclear size, and spreading through air spaces have been reported as predictors of unfavorable prognosis.130134 An alveolar space-filling growth pattern is characterized by cohesive aggregates of malignant squamous cells filling airspaces with intact alveolar septa. As a general rule, the epithelial keratins are coexpressed in specific pairings with one from each type.4 For example, in the basal layer the keratins are K5 and K14 and in the suprabasal layers K1 and K10. Cell cycle profile was determined by flow cytometry. The tumorigenic potential of K14 knockdown cells was determined by tumor formation upon subcutaneous injection in nude mice. 1, 6 November 2014 | Molecular Biology Reports, Vol. ***, p < 0.001 for K14; ***, p < 0.001 for K5. The baleen plates of filter-feeding whales are made of keratin. K14-deficient cells demonstrated substantial reduction in cell proliferation, decrease in phospho-Akt levels, increase in activated Notch1 levels, and increase in levels of keratinocyte differentiation markers. At the desired time points, 100 l of the medium was replenished from the designated wells, and 20 l MTT solution was added to each well. As these cells move upward and differentiate, K5/K14 levels are gradually reduced and expression of a new pair of keratins is induced, depending upon the tissue type (Fuchs and Green, 1980). When it comes to improving the extractability of keratins and KAPs for mass spectroscopic analysis, there are a number of approaches available. [14], The first sequences of keratins were determined by Israel Hanukoglu and Elaine Fuchs (1982, 1983). (A and B) Cell proliferation curves of K14 knockdown and vector control cells using MTT assay. 12, 29 April 2020 | Frontiers in Bioengineering and Biotechnology, Vol. 1, 18 December 2013 | Journal of Tissue Engineering, Vol. Confocal microscopy analysis also demonstrated an increased number of involucrin- and K1-expressing cells in K14 knockdown (shRK14-D1 and -D2) compared with vector control (pTU6-Hac) clone (Figure 4E). 22, No. It is the key structural material making up scales, hair, nails, feathers, horns, claws, hooves, and the outer layer of skin among vertebrates. The type I keratins are further subdivided numerically from K10 to K20 and the type II keratins from K1 to K9. 2, 20 November 2014 | Journal of Histochemistry & Cytochemistry, Vol. 26, 18 February 2021 | Cancers, Vol. The constituent proteins may be phylogenetically homologous but differ somewhat in chemical structure and supermolecular organization. The K14 knockdown clones demonstrated substantial decreases in the levels of the K14 partner K5. SYBR Green Master Mix (Applied Biosystems, Bedford, MA) was used with 200 nM of forward and reverse primers (Supplemental Table S3). Swallowed AF lipid and carbohydrates unlikely contribute significantly to fetal nutrition, and nutritional supplementation via AF does is not improve weight-gain in experimental fetal growth restriction (Buchmiller etal., 1994). H.A., S.T.K., and L.S.
49, No. For example, mouse thymic epithelial cells react with antibodies for keratin 5, keratin 8, and keratin 14. 2, 30 October 2014 | Molecular Medicine Reports, Vol. The constructs were validated by testing their efficiency to inhibit the expression of an exogenously expressed green fluorescent protein (GFP)-tagged K14 construct. Keratins (Ks) are the largest subgroup of intermediate filament (IF) proteins preferentially expressed in epithelial tissues (Moll et al., 1982; Coulombe and Omary, 2002). 12, No. The structure of the spinnerets on spiders tails, and the contributions of their interior glands, provide remarkable control of fast extrusion. The two main categories of ichthyotic diseases are whether they are limited to the skin or have syndromic associations. The heptad-repeat structure within the central domain of keratin monomers facilitates filament formation (Albers, 1996). Further, cellcell adhesion was analyzed by hanging drop assay. 7, The Kaohsiung Journal of Medical Sciences, Vol. 7, 31 December 2019 | Biochemical Genetics, Vol. 19, 1 September 2021 | Molecules, Vol. -Actin was used as a loading control. 9, 12 November 2018 | Journal of Biomedical Materials Research Part B: Applied Biomaterials, Vol. [3][4] Excessive keratinization participate in fortification of certain tissues such as in horns of cattle and rhinos, and armadillos' osteoderm. 1, Journal of Industrial and Engineering Chemistry, Vol. It is possible that K14 may not be the determinant of terminal differentiation, especially during fetal development, but K5 and K14 may act as modulators of terminal differentiation in the adult stage. Apart from the cytoprotective functions of K14, very little is known about K14 regulatory functions, since the K14 knockout mice show postnatal lethality. To determine whether reduced cell proliferation and enhanced activated-Notch1 levels resulting from K14 knockdown have any effect on tumorigenic potential of cells, in vivo tumorigenicity assays were performed. Keratins are cytoplasmic intermediate filament proteins preferentially expressed by epithelial tissues in a site-specific and differentiation-dependent manner. The keratohyaline granules which give the identifying features to the granular layer result from the accumulation of newly synthesized proteins. The use of ionic liquids adds another dimension to the mass spectral identification of proteins because it is complementary to the standard extraction method in its use of a chaotrope and reductant, the use of the two in combination leading to the identification of more proteins than either one alone. 4, No. In contrast, Reichelt et al. The process of squamous differentiation requires precision in coordinating the molecular events that lead to generation of a stratified epithelium. [5] The only other biological matter known to approximate the toughness of keratinized tissue is chitin. 4, 1 July 2020 | Biofabrication, Vol. K14 null mice demonstrate extensive blistering and die 2 d after birth, indicating the functional importance of K14 in maintaining mechanical integrity of the stratified epithelial cells (Chan et al., 1994; Rugg et al., 1994). 32, No. They are found in the nails, scales, and claws of reptiles, in some reptile shells (testudines, such as tortoise, turtle, terrapin), and in the feathers, beaks, and claws of birds. 237, No. cDNA was prepared as described in the preceding section and used as templates for PCR. quizlet lecture integumentary system layers epidermis cells 14, 6 October 2021 | Carcinogenesis, Vol. In a recent report, it was proposed that transgenic mice expressing K10 under K5 promoter display altered differentiation and changes in expression of the Notch family of proteins in thymic epithelial cells (Santos et al., 2005). Spider silk is classified as keratin,[9] although production of the protein may have evolved independently of the process in vertebrates. The protein levels of involucrin were significantly upregulated in K14 knockdown cells compared with vector control cells (Figure 4, A and B). independently of stem cell markers in submandibular salivary gland epithelium, Low-cysteine alpha-keratins and corneous beta-proteins are initially formed in the regenerating tail epidermis of lizard, Detection and quantification of epithelial progenitor cell populations in human healthy and IPF lungs, Hyperglycemia Induces Skin Barrier Dysfunctions with Impairment of Epidermal Integrity in Non-Wounded Skin of Type 1 Diabetic Mice, Invitro effects of sex hormones in human meibomian gland epithelial cells, Repeated exposure to whole cigarette smoke promotes primary human gingival epithelial cell growth and modulates keratin expression, Antibacterial and ciprofloxacin modulating activity of
These substances appear to have significant trophic effects in the intestinal mucosa (Underwood etal., 2005). Our results therefore suggest that K14 knockdown leads to substantial reduction in cell proliferation. AW135167 clones (both K14-knockdown and vector control cells) were suspended in plain IMDM without serum, 3 106 cells were injected subcutaneously in the dorsal flank of 6- to 8-wk-old NMRI nude mice. Metastatic urothelial carcinoma, metastases from or direct extension of thymic squamous cell carcinoma, and metastases from squamous cell carcinomas of other organs enter into the differential diagnoses. Cornification is the process of forming an epidermal barrier in They are obligatory heteropolymers and are assembled in 1:1 molar ratio, consisting of one type I and one type II keratin (Moll et al., 1982; Coulombe and Omary, 2002; Herrmann and Aebi, 2004). 1, 1 January 2014 | J. GAPDH was used as internal control. One set of cells was kept unsynchronized (with 10% FBS) as control. 22, No. Consistent with these findings, K14 knockdown cells also showed delayed M-phase entry (Figure 2, A and B) and reduction in the levels of histone-H3 phosphorylation at serine 10 (Figure 3B). [clarification needed] That model is now understood to be correct. The cells were then washed twice with PBS and fed with fresh complete medium with 10% fetal bovine serum (FBS). No significant difference in mRNA levels of Notch1 and Notch2 were observed by real-time PCR in the K14 knockdown cells when compared with the vector control cells (Figure S3A). Human hair is approximately 14% cysteine. In this study, we have investigated the role of K14 in cell proliferation, differentiation, and neoplastic progression using RNA interference. Recently K8 has also been shown to interact with Akt1, and regulate its phosphorylation in a glycosylation-dependent manner in simple epithelial cells (Ku et al., 2011). Cells were harvested at the indicated time points for the next 42 h and fixed with propidium iodide as described earlier (Hosing et al., 2008). This in turn induces expression of target genes, which leads to cell cycle arrest and initiation of cell differentiation (Bray, 2006; Watt et al., 2008). (2008) showed that transgenic mice expressing human K14 in the lung epithelium initiated a squamous differentiation program but failed to promote squamous maturation, suggesting K14 may have a role in cell differentiation of squamous epithelia. The selected sequences were analyzed by BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to ensure their specificity to their target mRNA. (Kim et al., 2006). 12, No. No significant difference in protein expression (Figure S2, A and C) and filament formation of K8 or K18 was observed in these clones (Figure S2, B and D). The complex network of keratin filaments in stratified epithelia is tightly regulated during squamous cell differentiation. 30, No. Scale bars: 10 m. Total mRNA levels of involucrin and K1 increased considerably in K14-knocdown cells (shRK14-D1 and -D2) as determined by real-time PCR (Figure 4C, D). GARY L. ELLIS, PAUL L. AUCLAIR, in Modern Surgical Pathology (Second Edition), 2009. 4, 27 November 2017 | Journal of Molecular Histology, Vol. Keratin filaments are intermediate filaments. It has been proposed that keratins can be divided into 'hard' and 'soft' forms, or 'cytokeratins' and 'other keratins'. 32, The American Journal of Human Genetics, Vol. 9, No. 1, 25 June 2013 | International Journal of Oncology, Vol. 35, No. 8, No. Antimicrobial substances are also present in AF, such as -defensins [HNP13] and lactoferrin (Underwood etal., 2005). 11, 6 January 2016 | Journal of Periodontal Research, Vol. 5, Molecular Genetics and Metabolism Reports, Vol. 115, 18 June 2015 | Histopathology, Vol. This is accompanied by an inhibition of cell cycle progression and proliferation. [17], Fibrous keratin molecules supercoil to form a very stable, left-handed superhelical motif to multimerise, forming filaments consisting of multiple copies of the keratin monomer. This pattern is occasionally seen in peripheral squamous cell carcinomas and is associated with a favorable prognosis.135,136 Squamous cell carcinomas may also spread superficially along the airways, thus assessment of the bronchial resection margin is extremely important. Nonkeratinizing squamous cell carcinoma should show diffuse staining for p40this being more specific for squamous cell carcinoma than p63 or CK5/6and absence of TTF-1 and napsin A; however, weak and focal TTF-1 expression may be seen in rare cases depending on choice of antibody clone.137,137a. The evolutionary relationships are complex and only partially known. The K14-knockdown clones (shRK14-D1 and -D2) showed decreased cell proliferation in comparison with vector control cells, as determined by MTT assay (Figure 2, A and B). These clones demonstrated significant reduction in protein level (Figure 1A) and 60% decrease in filament formation of K14's normal partner K5 (Figure 1C). 10, Journal of Dental Research, Vol. (D and E) mRNA levels of involucrin and K1 in indicated clones were determined by real-time PCR analysis. K14 expression (both mRNA and protein) in shRNAK14.4-transfected stable clones (shRK14-D1, -D2, and -D6 derived from HaCaT and shRK14-K7, -K9, and -K16 derived from AW13516) was determined by RT-PCR and Western blot analysis respectively. 2, 10 February 2022 | The Laryngoscope, Vol. The new term corneous beta protein (CBP) has been proposed to avoid confusion with -keratins.[12]. Keratin comes in two types, the primitive, softer forms found in all vertebrates and harder, derived forms found only among sauropsids (reptiles and birds). The more flexible and elastic keratins of hair have fewer interchain disulfide bridges than the keratins in mammalian fingernails, hooves and claws (homologous structures), which are harder and more like their analogs in other vertebrate classes. The central rod domain plays a critical role in filament assembly. (B) RT-PCR analysis of K14 in stable K14 knockdown and the respective vector control clones. In addition, aberrant Notch signaling has been linked to a wide variety of tumors (Allenspach et al., 2002) and its function as a tumor suppressor in the epidermis has been illustrated by transgenic studies (Proweller et al., 2006; Dotto, 2008). 1, 16 September 2019 | Journal of Clinical Investigation, Vol. [4] Keratin filaments are abundant in keratinocytes in the hornified layer of the epidermis; these are proteins which have undergone keratinization. Furthermore, we observed reduction in the percentage of K14 knockdown cells entering in M phase compared with vector control cells, as analyzed by flow cytometry (Figure 3A). In addition, K5 and K14 negatively regulate the cell differentiation program through the Notch 1 signaling pathway. shRNA-resistant GFP-tagged K14 construct was generated by introducing a silent mutation in the target sequence of shRNAs using the Quick change site-directed mutagenesis kit (Stratagene, Agilent, Santa Clara, CA). 12, No. 25, No. Previous reports have shown that K5 and K14 are specifically expressed in the mitotically active basal layer of the stratified epithelia, which contains epidermal stem cells and TA cells (Fuchs and Green, 1980). This article is distributed by The American Society for Cell Biology under license from the author(s). The academy is established to help players from Ghana and across Africa gain recognition and advance their football careers. All Rights Reserved Design & Developed By:: RINJAcom, For enquary We can help:: +233 (0) 24-611-9999. 12, No. 1, American Journal of Respiratory and Critical Care Medicine, Vol. Copyright 2022 Elsevier B.V. or its licensors or contributors. -Actin was used as a loading control. To understand whether K14 modulates cell proliferation in these cells via the PI3K/Akt pathway, activation of Akt, that is, the level of phosphorylation of Akt, was studied using Western blot analysis. To understand whether K14 loss leads to the phenotypic changes indicative of cell differentiation, the levels of keratinocyte differentiation markers such as involucrin and K1 were determined in K14 knockdown cells (HaCaT and AW13516) using Western blot analysis, real-time PCR and confocal microscopy. 6, The American Journal of Pathology, Vol. 5, 27 July 2016 | Biotechnology & Biotechnological Equipment, Vol. In recent years, increasing evidence suggests that Notch1 plays a key role in controlling epidermal proliferation and differentiation and acts as direct determinant of keratinocyte growth arrest and entry into the program of cell differentiation (Rangarajan et al., 2001). Breaking this network involves the use of reductants with chaotropes being required to solubilize the proteins. were supported by fellowships from the Council of Scientific and Industrial Research, University Grants Commission, and DBT, Government of India, respectively. The serine/threonine protein kinase Akt, also known as protein kinase B (PKB), is a downstream target of PI3-kinase. 12, 13 October 2021 | Biomedical Materials, Vol. The -keratins of reptiles and birds have -pleated sheets twisted together, then stabilized and hardened by disulfide bridges. These results suggest that K14 knockdown leads to delayed S-phase progression and late entry in M phase. 298, No. Moreover, the average size of colonies formed by K14 knockdown cells was smaller than for colonies formed by vector control cells (Figure 2, C and D), which correlates with the slower proliferation rate. 142, 3 August 2019 | Oral Cancer, Vol. 3-4, 28 August 2019 | Journal of Translational Medicine, Vol. The cell line AW13516 derived from the SCC of human tongue was cultured in Iscove's Modified Dulbecco's Medium (IMDM; Gibco; Tatake et al., 1990) supplemented with 10% FBS (Hyclone) and antibiotics at 37C and 5% CO2. 17, 3 July 2021 | International Journal of Molecular Sciences, Vol. These observations suggest that K5 and K14 have some role in promoting and/or maintaining cell proliferation in basal cells. Abnormal growth of keratin can occur in a variety of conditions including keratosis, hyperkeratosis and keratoderma. 13, No. 10, No. To detect the localization of proteins and filament organization of keratins in cells, immunofluorescence assay was performed as described previously (Raul et al., 2004). 5, No. 1, 20 July 2018 | Genome Medicine, Vol. [18], The major force that keeps the coiled-coil structure is hydrophobic interactions between apolar residues along the keratins helical segments.[19]. All amplifications were done three times in triplicate. 278, No. Increase in tumorigenicity in response to increased cell proliferation and PI3K/Akt activation has been well documented (Vivanco and Sawyers, 2002). 5, No. The following antibodies were used: K14 (mouse monoclonal, clone LL002; AbD Serotec, Oxford, UK; working dilution 1:5000), K5 (mouse monoclonal, clone XM26; working dilution 1:1000; NovoCastra, Newcastle, UK), K8 (mouse monoclonal, clone M20; working dilution 1:5000; Sigma, St. Louis, MO) K18 (mouse monoclonal, clone CY-90; working dilution 1:10,000; Sigma), -actin (mouse monoclonal, clone AC-74; working dilution 1:8000; Sigma), phosphoAkt (rabbit polyclonal; working dilution 1:1000; Abcam, Cambridge, UK), Akt (rabbit polyclonal; working dilution 1:1000; Abcam), Notch 1 (rabbit polyclonal, working dilution 1:1000; Abcam), Notch1 (sheep polyclonal; working dilution 1:1000; R&D Systems, Minneapolis, MN), Ki67 (mouse monoclonal; NovoCastra; Bond ready to use), p21 (rabbit polyclonal, clone C-19; working dilution 1: 200; Santa Cruz Biotechnology, Santa Cruz, CA), p27 (rabbit polyclonal, clone C-19; working dilution 1:100; Santa Cruz Biotechnology), secondary antibody HRP-conjugated anti-mouse, anti-rabbit (working dilution 1:8000; GE Healthcare UK), anti-sheep (working dilution 1:2000; Sigma).
Office Of Foreign Disaster Assistance, Nba 2k21 Best User Created Rosters, Ny Lottery Payout For 3 Numbers, What Happened To April On Chicago Med, You Aren't Invited Sweater, Fidelity Of Implementation Of The Kindergarten Curriculum, Rdr2 Horse Fence Location, Philip Yancey Quotes On Suffering, Word For Pretending To Do Something,